wecD

Information for wecD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3971220-3972101 + CDS rffH EG11454 glucose-1-phosphate thymidylyltransferase 3972208-3972753 + CDS wecD EG11455 orf; hypothetical protein 3972758-3973888 + CDS wecE EG11456 putative regulator

Reported regulatory sites for wecD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.322 3972112-3972131 taacc TGGGAAAACGCCTTCTTTGG tgtta - 0 - 1.870 3972178-3972199 tcctg ACGCCAGACGCGTTAGCGCCGT ggtca - 0 - 1.186 3972136-3972155 gtgtt AACAGCGCCATCGTGCGCAT tacgt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back