wza

Information for wza, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2133677-2134120 - CDS wzb EG13567 probable protein-tyrosine-phosphatase 2134126-2135265 - CDS wza EG13566 putative polysaccharide export protein 2135858-2137507 + CDS yegH EG14051 putative transport protein

Reported regulatory sites for wza: Genome coordinates Source Transcription factor Transcription factor annotation 2135695-2135724 PMID: 10702265 rcsAB positive response regulator for colanic capsule biosynthesis (sensor RcsC)

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.988 2135273-2135295 R cagga TAATTACTCTGCCAAAGTGATAA ataaa - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.461 2135330-2135350 R ttatt CAATTAACTGCAAGGTAAATG tgcat - 0 - 3.953 2135342-2135365 R atgcc AGTTAAATTTTTATTCAATTAACT gcaag - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back