xapA

Information for xapA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2520749-2522005 - CDS xapB EG13159 xanthosine permease 2522065-2522898 - CDS xapA EG20250 xanthosine phosphorylase 2523147-2523911 + CDS yfeN EG13160 putative sugar hydrolase

Reported regulatory sites for xapA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.461 2523009-2523031 R cgtgg ATTAATAGAGAAAAGATATAAAT ccatc - 0 - 4.461 2522984-2523006 R aatcc ATCGATATCGAATCGCTATTGAA tgcgt - 0 - 4.112 2523102-2523123 R gatcg TTATTAGTAGATTGCTTAATAA agtgg - 0 - 2.285 2523034-2523056 R ttaat ATCGCCAATACAGTTTTTACCGT ggatt - 0 - 2.285 2522959-2522981 R gaatg CGTGAGAAAAGTGTATTGGTAAG agccg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back