xapB

Information for xapB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2519613-2520497 - CDS xapR EG11146 regulator for xapA 2520749-2522005 - CDS xapB EG13159 xanthosine permease 2522065-2522898 - CDS xapA EG20250 xanthosine phosphorylase

Reported regulatory sites for xapB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.603 2522016-2522037 R cgcgg GTGAGGCCAAATGATGCGACAA ggaaa - 0 - 1.144 2522030-2522047 R gaaac GGCCTCGCGGGTGAGGCC aaatg - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back