xapR

Information for xapR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2519273-2519348 + tRNA lysV EG30056 Lysine tRNA 2519613-2520497 - CDS xapR EG11146 regulator for xapA 2520749-2522005 - CDS xapB EG13159 xanthosine permease

Reported regulatory sites for xapR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.675 2520575-2520598 R ccggg TATATTATCCATTGTGTTTATGTA tgtcg - 0 - 1.675 2520531-2520554 R ggtga AATACTTTATGCCATGATAATTTA atacg - 0 - 1.127 2520591-2520611 R accaa ATGTATTACCGGGTATATTAT ccatt - 0 - 1.127 2520515-2520535 R tgata ATTTAATACGATGTATTTATT atatg - 0 - 0.483 2520675-2520696 R aatta GTGAAAGATATTTTATTTTCTT ccggc - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back