xasA

Information for xasA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1565528-1566847 - CDS b1491 EG13794 orf; hypothetical protein 1566978-1568513 - CDS xasA EG12456 acid sensitivity protein; putative transporter 1568669-1570069 - CDS gadB EG11490 glutamate decarboxylase isozyme

Reported regulatory sites for xasA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.044 1568627-1568644 R tgtcc CGAAACGAACCCGTTTCG ggaca - 0 - - 0.995 1568566-1568587 R aacgg AAAATATTGTTCTGAATACGCT tcaga - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back