xseB

Information for xseB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 439426-440325 - CDS ispA EG10508 geranyltranstransferase (farnesyldiphosphate synthase) 440325-440567 - CDS xseB EG11098 exonuclease VII; small subunit 440773-442221 + CDS yajK EG13273 putative oxidoreductase

Reported regulatory sites for xseB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.573 440687-440708 R cacac CTGCGGCTGCATCCAGGCGCGG aagta - 0 - 1.966 440752-440770 R catgg CGGCAATGGTTCGTTGGCA agcct - 0 - 1.966 440605-440623 R ctatt TGCCCTGAGTCCGTTACCA tgacg - 0 - 1.883 440570-440586 R aatat TGAGAGTCAGACATTCA ttatg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back