xylA

Information for xylA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3725546-3727000 - CDS xylB EG11075 xylulokinase 3727072-3728394 - CDS xylA EG11074 D-xylose isomerase 3728760-3729752 + CDS xylF EG20252 xylose binding protein transport system

Reported regulatory sites for xylA: Genome coordinates Source Transcription factor Transcription factor annotation 3728471-3728507 PMID: 9371449 xylR putative regulator of xyl operon 3728622-3728657 PMID: 9371449 xylR putative regulator of xyl operon

Species with an ortholog: HI ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.177 3728489-3728505 R acttg TGAATTATCTCAATAGC agtgt xylR 17 - 5.177 3728468-3728484 R cagtg TGAAATAACATAATTGA gcaac xylR 14 - 1.517 3728597-3728618 R tcttg ATTTATGACCGAGATCTTACTT ttgtt - 0 - 1.517 3728507-3728528 R tttta TTTTGCGAGCGAGCGCACACTT gtgaa xylR 1 - 1.495 3728684-3728706 R accgc GATAAACGTAACCAATTTTTAGC aacta - 0 - 1.495 3728649-3728671 R caggg GAAAACAATTACAGATTTTTATC tttcg xylR 9 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back