xylB

Information for xylB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3725036-3725389 - CDS yiaB EG11267 orf; hypothetical protein 3725546-3727000 - CDS xylB EG11075 xylulokinase 3727072-3728394 - CDS xylA EG11074 D-xylose isomerase

Reported regulatory sites for xylB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.703 3727024-3727047 R ttggc CCGGTTATCGGTAGCGATACCGGG cattt - 0 - 1.331 3727051-3727073 R caaat AACGGCTAACTGTGCAGTCCGTT ggccc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back