xylE

Information for xylE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4237904-4238314 + CDS yjbA EG11209 orf; hypothetical protein 4238358-4239833 - CDS xylE EG11076 xylose-proton symport 4240205-4241095 - CDS malG EG10556 part of maltose permease; inner membrane

Reported regulatory sites for xylE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.689 4239970-4239993 R acggc AATAGTATTGTTTTTATCAATTTT ggata - 0 - 1.686 4239955-4239972 R tcaat TTTGGATAATTATCACAA ttaag - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back