xylF

Information for xylF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3727072-3728394 - CDS xylA EG11074 D-xylose isomerase 3728760-3729752 + CDS xylF EG20252 xylose binding protein transport system 3729830-3731371 + CDS xylG EG12275 putative ATP-binding protein of xylose transport system

Reported regulatory sites for xylF: Genome coordinates Source Transcription factor Transcription factor annotation 3728471-3728507 PMID: 9371449 xylR putative regulator of xyl operon 3728622-3728657 PMID: 9371449 xylR putative regulator of xyl operon

Species with an ortholog: HI EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.160 3728468-3728484 gttgc TCAATTATGTTATTTCA cactg xylR 14 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.657 3728635-3728658 ccaaa AATCGTAATCGAAAGATAAAAATC tgtaa xylR 23 - 0.315 3728711-3728732 cgcgg TGATTGTTACTTATTAAAACTG tcctc - 0 -

Critical MAP values: p=0.01 4.78 p=0.05 3.24 p=0.1 2.72 p=0.2 2.16

Click here to go back