yaaA

Information for yaaA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 5234-5530 + CDS b0005 EG14384 orf; hypothetical protein 5683-6459 - CDS yaaA EG10011 orf; hypothetical protein 6529-7959 - CDS yaaJ EG11555 inner membrane transport protein

Reported regulatory sites for yaaA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.195 6460-6483 R tcggc ATAAATTTCCTGCAAGGACTGGAT atgct - 0 - 1.127 6487-6502 R ttctc ATTTTTTGCTAAAGTC ggcat - 0 - 0.332 6513-6531 R aggag TAATCACAACTATCGATCA actca - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back