yaaH

Information for yaaH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 9306-9893 + CDS mog EG11511 required for the efficient incorporation of molybdate into molybdoproteins 9928-10494 - CDS yaaH EG11512 orf; hypothetical protein 10643-11356 - CDS b0011 EG14340 putative oxidoreductase

Reported regulatory sites for yaaH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.307 10610-10631 R aaacc GGGGAAAATTTTCATTTTCCCC tcaaa - 0 - 2.507 10563-10584 R cccca CTGGCTGATTATTATGCCGCGC cctga - 0 - 1.628 10529-10548 R actac AGTTATTCAGGGAAATTATT tcacc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back