yaaI

Information for yaaI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 10643-11356 - CDS b0011 EG14340 putative oxidoreductase 11382-11786 - CDS yaaI EG11513 orf; hypothetical protein 12163-14079 + CDS dnaK EG10241 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins

Reported regulatory sites for yaaI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.356 11990-12006 R gggag ATGCAAAAATTTTTTGT gcttt - 0 - 2.596 11913-11933 R gcaat TTTATTCATATAAAGAATGAA tcgca - 0 - 2.596 11871-11891 R catca AAAAATTGTAATAAAAAGAAA agatt - 0 - 2.471 12010-12025 R gtaaa CCACGTCATCAAGGGG gagat - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back