yaaJ

Information for yaaJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 5683-6459 - CDS yaaA EG10011 orf; hypothetical protein 6529-7959 - CDS yaaJ EG11555 inner membrane transport protein 8238-9191 + CDS talB EG11556 transaldolase B

Reported regulatory sites for yaaJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.190 8187-8205 R taggg GGATGTAACCGGTCTGCCC tgatg - 0 - 1.799 8159-8182 R ctgat GATATCACGACGCAACGTCAGCGC aaccg - 0 - 1.799 7983-8006 R tggta ACGTTTACACAGGAAAGTCATCGC gaccg - 0 - 1.189 8208-8223 R tctct TTAAACAGCTTGTTAG gggga - 0 -

Critical MAP values: p=0.01 4.76 p=0.05 3.70 p=0.1 3.23 p=0.2 2.71

Click here to go back