yabB

Information for yabB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 88028-89032 + CDS fruR EG10338 transcriptional repressor of fru operon and others 89634-90092 + CDS yabB EG11084 orf; hypothetical protein 90094-91035 + CDS yabC EG11085 putative apolipoprotein

Reported regulatory sites for yabB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.522 89546-89566 cttgt GACTGGCTTGACAAGCTTTTC ctcag - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.665 89505-89526 tgata TTAGCCGTAAACATCGGGTTTT ttacc - 0 - 2.665 89578-89599 tccgt AAACTCCTTTCAGTGGGAAATT gtggg - 0 - 1.860 89369-89387 gtcgc AAACTGACACTTTATATTT gctgt - 0 - 1.860 89449-89467 tacag CTATTCATAACGTTAATTT gcttc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back