yabM

Information for yabM, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 75644-77299 - CDS yabN EG12094 putative transport protein 77621-78799 + CDS yabM EG11754 putative transport protein 78848-79453 - CDS leuD EG11575 isopropylmalate isomerase subunit

Reported regulatory sites for yabM: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.545 77345-77367 cccta TATTAAGTCAATAATTCCTAACG atgaa - 0 - 0.698 77367-77390 ctaac GATGAAGCAAGGGGGTGCCCCATG cgtca - 0 - 0.604 77557-77576 gtaaa ATCACCCGCCAGCAGATTAT acctg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back