yabN

Information for yabN, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 74497-75480 - CDS tbpA EG11574 thiamin-binding periplasmic protein 75644-77299 - CDS yabN EG12094 putative transport protein 77621-78799 + CDS yabM EG11754 putative transport protein

Reported regulatory sites for yabN: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.153 77565-77585 R aaaaa CCAGCAGGTATAATCTGCTGG cgggt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.423 77337-77355 R aatta TTGACTTAATATAGGGAAA ataaa - 0 - 2.421 77317-77336 R ggaaa ATAAAATTGCTGTCTTTTGC acagg - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back