yacE

Information for yacE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 111856-112599 - CDS yacF EG12313 orf; hypothetical protein 112599-113219 - CDS yacE EG12312 putative DNA repair protein 113444-114487 + CDS guaC EG10422 GMP reductase

Reported regulatory sites for yacE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.702 113320-113342 R gtctt TTTTTACGCTACAATCCCATAAA tttac - 0 - 1.669 113296-113319 R ataaa TTTACCTGGTAAATAGTGAGCGAA cgttt - 0 - 1.669 113239-113262 R cattt TTAACGTTTTGATAATCATGATGA attcc - 0 - 1.126 113415-113436 R gcgga TTCCTGGGGTTAATGGCTATAA gggta - 0 - 1.126 113374-113395 R ctcca GTGACGCTATCATACGCACTAA tcaat - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back