yacH

Information for yacH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 127912-129336 + CDS lpdA EG10543 lipoamide dehydrogenase (NADH); component of 2-oxodehydrogenase and pyruvate complexes; L-protein of glycine cleavage complex 129407-131260 - CDS yacH EG12315 putative membrane protein 131615-134212 + CDS acnB EG12316 aconitate hydrase B

Reported regulatory sites for yacH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.908 131450-131469 R aaaaa AGCAACATAAAAAAGTGGCT gaatc - 0 - 4.067 131546-131562 R tcacg CTCCTGTGAGACAGCAG tttgt - 0 - 4.017 131512-131532 R gtaaa TGCCCAGTACCGCAACGGGCA gaata - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back