yacL

Information for yacL, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 131615-134212 + CDS acnB EG12316 aconitate hydrase B 134340-134750 + CDS yacL EG12605 orf; hypothetical protein 134788-135582 - CDS speD EG10962 S-adenosylmethionine decarboxylase

Reported regulatory sites for yacL: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.593 134214-134237 ttaaa AAGTCAGCGCACGCGCTGCGCATA aacga - 0 - 3.593 134287-134310 tttct AAACCATCGCCGTTCCGCTGTTTT tctcc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back