yadE

Information for yadE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 144577-145017 + CDS yadI EG12322 putative PTS enzyme II B component 145081-146310 + CDS yadE EG11749 orf; hypothetical protein 146314-146694 - CDS panD EG11747 aspartate 1-decarboxylase

Reported regulatory sites for yadE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.053 145034-145055 gatgg CGCTTTTGCTACAATAAAAGCG ttgtt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back