yadF

Information for yadF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 141419-141967 + CDS hpt EG20098 hypoxanthine phosphoribosyltransferase 142008-142670 - CDS yadF EG12319 putative carbonic anhdrase (EC 4.2.1.1) 142779-143705 + CDS yadG EG12320 putative ATP-binding component of a transport system

Reported regulatory sites for yadF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.277 142704-142721 R cggag TTGCCCTATATTAGCCAA acgta - 0 - 1.653 142734-142756 R acgtt CTTACACTTTATCTGTGGTTTAA atcgt - 0 - 1.060 142757-142776 R cataa ATTTTTACTTACCTTACGTT cttac - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back