yadI

Information for yadI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 143702-144472 + CDS yadH EG12321 orf; hypothetical protein 144577-145017 + CDS yadI EG12322 putative PTS enzyme II B component 145081-146310 + CDS yadE EG11749 orf; hypothetical protein

Reported regulatory sites for yadI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.710 144507-144528 agagg AGTTTTGACGGCTATCACCCTT tatca - 0 - 2.646 144483-144504 tttcc TCTCCTCTGGATTTGGGGGAGA ggagt - 0 - 2.620 144555-144573 actga TTTTCGGCTAAGGAGGAAG gcgat - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back