yadN

Information for yadN, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 155461-156201 - CDS ecpD EG11973 probable pilin chaperone similar to PapD 156299-156883 - CDS yadN EG12328 putative fimbrial-like protein 157253-157732 - CDS folK EG11374 7;8-dihydro-6-hydroxymethylpterin- pyrophosphokinase

Reported regulatory sites for yadN: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.987 157065-157087 R tattt TTACTTAATTTTGAATTAAGTAA attta - 0 - 1.506 157211-157234 R cgaat ATAAATATTTTCTGAAAATCATAT ctcat - 0 - 1.506 157134-157157 R aaata ATATAACTTCCTATAAATAAATAT caatc - 0 - 0.435 157233-157251 R gtaat TTATTTATATTGCGAATAT aaata - 0 - 0.435 156935-156953 R ttctc CTATTTGTGTCATGAATAG tcatt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back