yadQ

Information for yadQ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 173602-174882 - CDS hemL EG10432 glutamate-1-semialdehyde aminotransferase (aminomutase) 175107-176528 + CDS yadQ EG12331 putative channel transporter 176610-176954 + CDS yadR EG12332 orf; hypothetical protein

Reported regulatory sites for yadQ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.513 175025-175045 gaaac ATTACGCTTTGCAAAGGATTT tcatg - 0 - 3.089 175004-175027 gtata AAAGTTTTGTGCATTTGAAACATT acgct - 0 - 2.999 175078-175094 catct TATTTGTATGACCAATA agtga - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back