yaeG

Information for yaeG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 180884-182308 + CDS htrA EG10463 periplasmic serine protease Do; heat shock protein HtrA 182445-183620 + CDS yaeG EG12335 orf; hypothetical protein 183709-184095 - CDS yaeH EG12336 putative structural protein

Reported regulatory sites for yaeG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.262 182354-182373 ttaca ATCTGTGAACTTCACCACAA ctcca - 0 - 2.262 182394-182413 tcatc CTTTAGGCATTTGCACAATG ccgta - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back