yaeM

Information for yaeM, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 192872-193429 + CDS frr EG10335 ribosome releasing factor 193521-194717 + CDS yaeM EG12715 putative ATP-binding component of a transport system 194903-195664 + CDS yaeS EG13329 orf; hypothetical protein

Reported regulatory sites for yaeM: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.186 193451-193474 aacgc CGCTCAGTAGATCCTTGCGGATCG gctgg - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back