yaeO

Information for yaeO, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 212331-213629 + CDS mesJ EG13220 cell cycle protein 213678-213938 - CDS yaeO EG13221 orf; hypothetical protein 214291-214836 + CDS yaeQ EG13223 orf; hypothetical protein

Reported regulatory sites for yaeO: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.592 214149-214172 R gtagg CTTAGACTTGCATCCACGGTTAAG tcaga - 0 - 4.215 214067-214085 R cgcgg AAATCGCCAGCGGAGACTT aggat - 0 - 3.758 213996-214019 R gaatg AAATGGCTGCCGACGACGCCCTTT ctgag - 0 - 3.758 213957-213980 R caggg AAAAAGCAGCATACGCTGCGGCAA actta - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back