yaeQ

Information for yaeQ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 213678-213938 - CDS yaeO EG13221 orf; hypothetical protein 214291-214836 + CDS yaeQ EG13223 orf; hypothetical protein 214833-215255 + CDS yaeJ EG12354 orf; hypothetical protein

Reported regulatory sites for yaeQ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.012 214101-214123 cttgc GTATTAACTCACAATATTTTTCC acatg - 0 - 3.384 213957-213980 taagt TTGCCGCAGCGTATGCTGCTTTTT ccctg - 0 - 3.384 213996-214019 ctcag AAAGGGCGTCGTCGGCAGCCATTT cattc - 0 - 2.913 214169-214190 aagtc TAAGCCTACGAAGATAAACTCT gtttc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back