yafB

Information for yafB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 228928-229004 + tRNA aspU EG30024 Aspartate tRNA1 triplicated gene; in rrnH operon 229167-229970 + CDS yafB EG11648 putative aldose reductase (EC 1.1.1.21) 229967-230881 - CDS yafC EG11649 putative transcriptional regulator LYSR-type

Reported regulatory sites for yafB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST PA YP EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.013 229058-229080 tatct ATTATTGCCAGAATCGCAAAAAT cctct - 0 - 3.551 229072-229095 agaat CGCAAAAATCCTCTGCATTTTACG ctctt - 0 - 2.719 229015-229038 taaga AGCCTCGAGTTAACGCTCGAGGTT ttttt - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back