yafC

Information for yafC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 229167-229970 + CDS yafB EG11648 putative aldose reductase (EC 1.1.1.21) 229967-230881 - CDS yafC EG11649 putative transcriptional regulator LYSR-type 231122-231922 + CDS yafD EG11650 orf; hypothetical protein

Reported regulatory sites for yafC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.379 230882-230900 R ttcta TTTTGCAACAGGAGCAAAA atgaa - 0 - 1.752 231073-231092 R gtcaa CCCTTCCGCACTCGGGAGGG ttcta - 0 - 1.232 230917-230939 R atcct GATGGTTTAATGACAAATAAATT caaaa - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back