yafD

Information for yafD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 229967-230881 - CDS yafC EG11649 putative transcriptional regulator LYSR-type 231122-231922 + CDS yafD EG11650 orf; hypothetical protein 231926-232549 + CDS yafE EG11651 putative biotin synthesis protein

Reported regulatory sites for yafD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.820 230997-231018 tgacc GGTGTAAGCACTTGCTTACATA acaat - 0 - 4.820 231036-231057 tgctc GTTGAAAGAGTGAGCTAAAATC cctat - 0 - 4.252 231071-231094 agtag AACCCTCCCGAGTGCGGAAGGGTT gacgt - 0 - 2.345 231049-231065 agtga GCTAAAATCCCTATAAC agtag - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back