yafJ

Information for yafJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 243543-244121 + CDS gmhA EG13146 phosphoheptose isomerase 244327-245094 + CDS yafJ EG13147 putative amidotransferase 245065-245805 - CDS yafK EG13148 orf; hypothetical protein

Reported regulatory sites for yafJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.001 244127-244143 gtctg GCGTAGGCCGGATAAGA cgttt - 0 REP17a (15) 3.001 244228-244244 gcgaa CCGTAGGCCGAATAATG cgttc - 0 REP17c (15) 1.758 244191-244214 gacgc TGACGCGTCTTATCATGCCTACAA atctg - 0 REP17b (22) 1.758 244246-244269 aatgc GTTCACGCCGCATCCGACCTGAAA attct - 0 REP17c (18) 0.592 244149-244164 cgttt ACGCCGCATCCGGCAT ttgtg - 0 REP17a (14) 0.592 244175-244190 cgctg ATGCCTGATGCGACGC tgacg - 0 REP17b (14)

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back