yafK

Information for yafK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 244327-245094 + CDS yafJ EG13147 putative amidotransferase 245065-245805 - CDS yafK EG13148 orf; hypothetical protein 245961-246239 - CDS yafQ EG13154 orf; hypothetical protein

Reported regulatory sites for yafK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.852 245859-245882 R ccttc CAAATCCAGACTATTCCGATTTGG gatcc - 0 - 2.744 245817-245838 R cctgg CGTGTGTAACCGTTTTATCAAG gaata - 0 - 0.142 245895-245918 R caggc TTGCGTAAAACTCTTTTGGTGATA atgtg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back