yafM

Information for yafM, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 246712-247461 + CDS yafL EG13149 putative lipoprotein 247637-248134 + CDS yafM EG13150 orf; hypothetical protein 248358-250097 - CDS fhiA EG13144 flagellar biosynthesis

Reported regulatory sites for yafM: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.194 247461-247483 ttgta GGACGGATAAGGCGTTTACGCCG catcc - 0 REP18a (23) 0.359 247558-247574 tattt GCGAGCCGCTTTCCCGA tataa - 0 -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back