yahK

Information for yahK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 340349-341731 + CDS yahJ EG13594 putative deaminase 342108-343157 + CDS yahK EG13595 putative oxidoreductase 343400-344215 + CDS yahL EG13596 orf; hypothetical protein

Reported regulatory sites for yahK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.314 341823-341846 aaatg GACATTATCTTTGAGGAATATGCC cttat - 0 - 0.314 341992-342015 ctcgc GGCATGTTGGGGCTGGATCGGGTG gttta - 0 -

Critical MAP values: p=0.01 3.34 p=0.05 2.41 p=0.1 2.01 p=0.2 1.55

Click here to go back