yahN

Information for yahN, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 344598-344873 + CDS yahM EG13597 orf; hypothetical protein 344890-345561 - CDS yahN EG13598 putative cytochrome subunit of dehydrogenase 345708-345983 + CDS yahO EG13599 orf; hypothetical protein

Reported regulatory sites for yahN: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.411 345675-345692 R cagag TTGTTATCACACTATCAC ccacc - 0 - 1.411 345583-345600 R acact TTGTGATCTCTCTCGCAC ccgat - 0 - 1.194 345639-345657 R ttggg TTGATTAATAATTAGTTCA gtcag - 0 - 0.640 345618-345637 R ttcag TCAGGGCATAAACGCCAGTA accgg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back