yaiA

Information for yaiA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 405629-406153 + CDS aroL EG10082 shikimate kinase II 406203-406394 + CDS yaiA EG11093 orf; hypothetical protein 406652-407329 + CDS aroM EG10083 protein of aro operon; regulated by aroR

Reported regulatory sites for yaiA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.678 406163-406183 cgagc GCCTATACTTAACGTTCATCC cgtga - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back