yaiB

Information for yaiB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 399053-400147 - CDS ddlA EG10213 D-alanine-D-alanine ligase A 400610-400870 + CDS yaiB EG11256 orf; hypothetical protein 400902-402386 + CDS phoA EG10727 alkaline phosphatase

Reported regulatory sites for yaiB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.484 400470-400485 aaata AGAGAAACGTTTCGCT ggtaa - 0 - 2.952 400366-400388 ttttt TCTCTTAATTATAAGTTAACGAA gagaa - 0 - 2.952 400398-400420 atata TTTCATAACTTTTATTTATAATA aaggt - 0 - 0.158 400540-400559 ataat ACTTCCAGACACTATGAAGT tgtga - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back