yaiC

Information for yaiC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 402487-402825 + CDS psiF EG11401 induced by phosphate starvation 402927-404042 + CDS yaiC EG11257 orf; hypothetical protein 404059-404868 - CDS proC EG10769 pyrroline-5-carboxylate reductase

Reported regulatory sites for yaiC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.347 402844-402867 taacg GGTGAGCTACGAAAATGGCTCACC cgaaa - 0 - 5.318 402902-402921 gtctc TATAATTTGGGAAAATTGTT tctga - 0 - 2.871 402868-402884 tcacc CGAAATATCATACTTCT gcctt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back