yaiE

Information for yaiE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 406652-407329 + CDS aroM EG10083 protein of aro operon; regulated by aroR 407401-407685 + CDS yaiE EG12159 orf; hypothetical protein 407893-408174 + CDS b0392 EG14282 orf; hypothetical protein

Reported regulatory sites for yaiE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.118 407341-407357 gtgac AGCCAGCGCCTCTGGCC cctat - 0 - 0.454 407379-407399 tgttc AACTACCAAACAGGGCCAGTT tatgc - 0 - 0.093 407328-407343 ggtgt AATTTTGCGTGACAGC cagcg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back