yaiH

Information for yaiH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 393685-394353 + CDS yaiV EG13607 orf; hypothetical protein 394354-395511 - CDS yaiH EG12867 putative enzyme 395863-397083 + CDS sbmA EG10928 sensitivity to microcin B17; possibly envelop protein

Reported regulatory sites for yaiH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.946 395546-395562 R tcaat GAGTAGTATAAATACGC tcagt - 0 - 1.201 395838-395853 R actcc TGCTAACTTCTTATCG tttta - 0 - 1.151 395710-395729 R ccata AGAATTGTTTCGACGGATTT cacaa - 0 - 1.151 395605-395624 R cgtgt TTACGCGCCGTTACGTTTTT aacac - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back