yaiM

Information for yaiM, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 375879-376535 + CDS yaiL EG13294 nucleoprotein/polynucleotide-associated enzyme 376759-377592 - CDS yaiM EG13295 putative esterase (EC 3.1.1.1) 377686-378795 - CDS adhC EG50010 alcohol dehydrogenase class III; formaldehyde dehydrogenase; glutathione-dependent

Reported regulatory sites for yaiM: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.171 377595-377617 R tccgg GGGATTAACCCTGAGATAATGAC tgatg - 0 - 0.000 377617-377634 R ctctc CCCGGGCAGCCGTCCGGG ggatt - 0 - -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back