yaiT

Information for yaiT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 389121-389390 - CDS b0370 - orf; hypothetical protein 389475-390935 + CDS yaiT EG13605 orf; hypothetical protein 390963-391829 - CDS tra5_1 - IS3 putative transposase

Reported regulatory sites for yaiT: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.642 389422-389442 tttct ATGCATTGATAATTGATGGAT caact - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.380 389450-389473 actta TTACGTCCCTGAGGAGGGATGACA aatgc - 0 - 3.767 389403-389419 agcgc GAAACATAATATGTTTT ctatg - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back