yaiU

Information for yaiU, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 391826-392134 - CDS b0373 - putative factor 392239-393642 + CDS yaiU EG13605 putative flagellin structural protein 393685-394353 + CDS yaiV EG13607 orf; hypothetical protein

Reported regulatory sites for yaiU: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.198 392203-392223 acctg TACGCCAATACTATCACCGTA actaa - 0 - 0.335 392217-392236 actat CACCGTAACTAACGGCGGTG tattg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back