yajD

Information for yajD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 428729-429700 + CDS secF EG10940 protein secretion; membrane protein 429829-430176 + CDS yajD EG11097 orf; hypothetical protein 430353-431237 - CDS tsx EG11035 nucleoside channel; receptor of phage T6 and colicin K

Reported regulatory sites for yajD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.565 429760-429777 tgtat GGAGATTGCGAAAATCCC cgcat - 0 - 2.565 429787-429804 tcttg GGAAACTGCGCGTAACCC tacat - 0 - 1.007 429806-429827 accct ACATTTCATCCAGGTAACTTTT catgg - 0 - 0.607 429700-429719 ccgta ATCAAGTTCCCGTTGATGTT gaaaa - 0 - 0.607 429732-429751 ccggt CAGAAGATCGGGATTTTTTT tgatg - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back