yajI

Information for yajI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 430353-431237 - CDS tsx EG11035 nucleoside channel; receptor of phage T6 and colicin K 431536-432135 - CDS yajI EG12874 orf; hypothetical protein 432226-432675 + CDS ybaD EG11320 orf; hypothetical protein

Reported regulatory sites for yajI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.945 432149-432167 R tacaa CAAAGGCGCAACGCTTTTG agata - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.197 432168-432191 R atcta TTTTACCCTGAACTGACGATACAA caaag - 0 - 2.738 432208-432225 R tgcat ACGGCGTCCTGACCAGGT ggtta - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back