yajO

Information for yajO, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 435813-436331 + CDS pgpA EG10704 phosphatidylglycerophosphatase 436385-437431 - CDS yajO EG13611 putative NAD(P)H-dependent xylose reductase 437539-439401 - CDS dxs EG13612 1-deoxyxylulose-5-phosphate synthase; flavoprotein

Reported regulatory sites for yajO: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.168 437498-437521 R tcctg CTATGCTTAAGAAATTATTCATAG actct - 0 IRU4 (3) 0.141 437441-437457 R cgagt GAAGCCCCAGGAGCTTA cataa - 0 IRU4 (17) - 0.000 437480-437497 R catag ACTCTAAATAATTCGAGT tgcag - 0 IRU4 (18) -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back