yajQ

Information for yajQ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 442828-443739 - CDS apbA EG13271 involved in thiamin biosynthesis; alternative pyrimidine biosynthesis 443889-444398 + CDS yajQ EG13613 orf; hypothetical protein 444526-445896 - CDS yajR EG13614 putative transport protein

Reported regulatory sites for yajQ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.606 443741-443759 tcatt GTTCCTCCTCACCCGCAAC cactc - 0 - 1.178 443783-443799 aggct ATCCCTTAATTGTGCAT gctgt - 0 - 1.178 443812-443828 cgact ATGCACAATTAAGGGAT acgtc - 0 - 1.163 443862-443882 taact TTGCGGGTATTATGCTTCGCA tcaaa - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back